genetic predisposition vitamin d deficiency

Unable to load your collection due to an error, Unable to load your delegates due to an error. 2017 Sep 11;18(1):424. doi: 10.1186/s13063-017-2141-y. Additionally, an increased risk of cardiovascular disease, obesity, diabetes, and cancer is linked with insufficient vitamin D … Written informed parental consent was given for the research and publication of the results of each infant included in the study. Please enable it to take advantage of the complete set of features! With dr. Judson you can learn how to fix sleep problems, loose weight and overall feel better. The analyses covered data on aforementioned determinants. We compared infants with gsVitD < 20th percentile to infants with gsVitD > 80th percentile by using t-test, Fisher’s exact test and the Bonferroni correction. Institute of Medical Biometrics and Statistics, University of Lübeck, Lübeck, Germany, Roles A vitamin D deficiency is defined as a circulating concentration of 25-hydroxyvitamin D lower than 30 nmol/L. SNPs were amplified by polymerase chain reaction and allelic discrimination was conducted with a sequence detecting system-software using the TaqMan® 7900 HT platform (Applied Biosystems). Competing interests: The authors have declared that no competing interests exist. Yes PLOS ONE promises fair, rigorous peer review, Reduced cerebellar volume, reduced intelligence quotient, cognitive impairments, behavioral problems, higher prevalence of arterial hypertension, childhood asthma and type 2 diabetes are long term complications of prematurity [13]. Genetic predisposition to certain skin cancers may be associated with vitamin D deficiency Date: October 20, 2010 Source: JAMA and Archives Journals One high profile controversy has been the role of vitamin D in the prevention and management of covid-19,12 so the National Institute for Health and Care Excellence (NICE), Public Health England, and the Scientific … We were not able to measure plasma vitamin D levels, which might be more reliable than genetic estimates since the effect of genetics might be diluted by dietary intake and vitamin D supplementation. Writing – original draft, Kołodziejczyk A, Borszewska-Kornacka MK, Seliga-Siwecka J. However, we acknowledge that our findings might differ if a variant genetic method was applied (different SNPs and SNP genotyping) and if the case number had been even larger. Writing – review & editing. Formal analysis, Percentile), intermediate and high vitamin D level estimates. Percental occurrence of bone fractures…, Fig 2. These complications are common and determine the prognosis of preterm infants [12]. Since prevalence of fractures at five years is very low, follow up of about 7,700 genotyped infants would be needed to confirm a risk difference of 1.5% (1.5% fracture risk in preterm infants with high genetic score vitamin D levels vs. 3.0% fracture risk in preterm infants with low genetic score vitamin D levels, for type I error level < 0.05 and power > 0.8). Modern lifestyles and decades-long admonitions from the medical community often deny us the most natural source of vitamin D: the sun. The prevalence of vitamin D deficiency, presenting as hypocalcemic seizures or rickets in children, is increasing worldwide due to insufficient vitamin D intake and lack of exposure to sunshine. Data Availability: Detailed data cannot be shared publicly because of ethical and privacy reasons imposed by the Ethics Committee at the University of Lübeck. The analyses covered data on aforementioned determinants. Jiang et al. Childhood asthma may be a consequence of vitamin D deficiency. and Manson et al. Careers. We excluded preterm infants with unsuccessful genotyping of three polymorphisms affecting vitamin D levels (see below) or incomplete follow-up data at five years. MOnitored supplementation of VItamin D in preterm infants (MOSVID trial): study protocol for a randomised controlled trial. Investigation, Vitamin D nutritional status in preterm infants and response to supplementation. Calcium independent symptoms of a vitamin D deficiency exist and can be explained by a ubiquitous occurrence of the vitamin D receptor [1]. Levels above 30ng/ml are consequently classified as sufficiency [9]. Yes Roles Vitamin D and risk of cause specific death: systematic review and meta-analysis of observational cohort and randomised intervention studies. Low genetic vitamin D level estimates could not be shown to be associated with previously described adverse outcome in preterm infants. Benefits are possible but evidence is sparse, indirect, and inconclusive The covid-19 pandemic has led to many unfounded and exaggerated claims about possible treatments. 2010. https://doi.org/10.1371/journal.pone.0230426.g002. De-Regil LM, Palacios C, Lombardo LK, Peña-Rosas JP. doi: 10.1002/14651858.CD008873.pub3. Fig 2 shows frequencies of bone fractures stratified for gsvitD. The SNP rs7944926 is located on chromosome 11 as well, close to the DHCR7-gene encoding7-Dehydrocholesterol reductase. The factors associated with such predisposition are not known. See this image and copyright information in PMC. Investigation, Supervision, The German Neonatal Network is a large-scale observational study with the aim to identify possible influencing factors for the outcome of preterm infants. McCarthy RA, McKenna MJ, Oyefeso O, Uduma O, Murray BF, Brady JJ, Kilbane MT, Murphy JF, Twomey A, O' Donnell CP, Murphy NP, Molloy EJ. Department of Pediatrics, University of Lübeck, Lübeck, Germany, Roles P-values are indicated for genotyped children with or without 5-year follow up data. Yet vitamin D deficiency is rampant around the globe. Methodology, No, PLOS is a nonprofit 501(c)(3) corporation, #C2354500, based in San Francisco, California, US, TTCTCATGTAGACATGGGGAAGCTC[A/G]GATGAGGCTGCCAGGGAATAGATGT, ATTTGCTCAGAGCAAATCTAGTTG[A/G]ACTGAAGAAGGCTTGGCCAAAACTA, AAAGCTAACAATAAAAAATACCTGGC[T/G]TGTGAGATAATTAAGAGACAGAGATTTGC, https://doi.org/10.1371/journal.pone.0230426. Cochrane Database Syst Rev. The intraventricular haemorrhage (IVH) is divided into four degrees of severity and ranges from bleeding in the germinal matrix to haemorrhagic infarction [18]. Investigation, The findings of this study support two large recently published randomized studies by Roth et al. Low genetic vitamin D level estimates could not be shown to be associated with any adverse outcome measures examined. Despite routine supplementation of vitamin D, a wide range of complications related to vitamin D deficiency has been described in the literature. Prematurity is associated with a variety of short-term complications: respiratory (bronchopulmonary dysplasia (BPD)), neurological (intraventricular hemorrhage (IVH), periventricular leukomalacia (PVL)) abdominal (necrotizing enterocolitis (NEC)) complications, retinopathy of prematurity as well as sepsis and rickets of prematurity. Genetic predisposition to certain skin cancers may be associated with vitamin D deficiency. As an extension we tested this hypothesis according to birth weight, gestational age and weight, height and head circumference at five years. Single nucleotide vitamin D receptor polymorphisms (FokI, BsmI, ApaI, and TaqI) in the pathogenesis of prematurity complications. https://doi.org/10.1371/journal.pone.0230426, Editor: Umberto Simeoni, Centre Hospitalier Universitaire Vaudois, FRANCE, Received: October 1, 2019; Accepted: February 28, 2020; Published: March 31, 2020. Since standard vitamin D supplementation might be not sufficient in preterm infants with a genetic predisposition for vitamin D deficiency, we investigated the outcome of preterm infants with regard to their genetic estimated vitamin D levels. There are several forms of the condition that are distinguished primarily by their genetic causes: type 1A (VDDR1A), type 1B (VDDR1B), and type 2A (VDDR2A). To exclude the risk of “survival bias”, we analyzed mortality in all infants with successful genotyping. Privacy, Help No, Is the Subject Area "Infants" applicable to this article? This result does not remain significant after being adjusted by the Bonferroni correction (adjusted p-value for 9 comparisons = 0.324). Preterm infants with a birth weight below 1500 grams were included in the German Neonatal Network at the time of their birth and tested at the age of five. Holick defines a vitamin D deficiency as 25(OH)D levels below 20ng/ml and levels between 21 and 29ng/ml as insufficiency. September 6;411(17–18):1354–60. We analyzed genetic factors altering vitamin D levels in a large cohort of preterm infants to determine if infants with a genetic predisposition for low vitamin D levels are at higher risk for short term complications of prematurity or long term growth failure and bone fractures. Despite the large study population our data shows no association between low genetic vitamin D level estimates and adverse outcome of very low birth weight infants. Funding acquisition, The most common reason for missing follow-up data was the age of the child, since all children with follow-up were born between 2009 and 2013, but genetic testing was done in children born between 2009 and 2015. Percentile), intermediate and high vitamin D level estimates. No significant differences were observed. Whether genetic predisposition modifies response to sun exposure or dietary supplementation warrants further study, especially in view of the large interindividual differences that have been reported in response to treatment with identical doses of vitamin D. 33 Furthermore, these variants might provide useful genetic approaches to investigate the role of vitamin D insufficiency in … Conceptualization, During the stay in the hospital, the deoxyribonucleic acid (DNA) of the neonate was collected (umbilical cord tissue and buccal-swab). The type I error level was set to 0.05. By ... on the biological basis of the so-called sunshine vitamin. However, only 45 of 1924 (2.3%) children had a bone fractures until the age of five. https://doi.org/10.1371/journal.pone.0230426.t001. Context sequences for primers were rs12794714: TTCTCATGTAGACATGGGGAAGCTC[A/G]GATGAGGCTGCCAGGGAATAGATGT; rs7944926:ATTTGCTCAGAGCAAATCTAGTTG[A/G]ACTGAAGAAGGCTTGGCCAAAACTA and rs2282679:AAAGCTAACAATAAAAAATACCTGGC[T/G]TGTGAGATAATTAAGAGACAGAGATTTGC. Related Articles Low Vitamin D Levels for Skin Cancer Patients (webmd.com) Can Vitamin D Deficiency Cause Crohn's? (2020) Genetic predisposition for vitamin D deficiency is not associated with adverse outcome of very low birth weight infants: A cohort study from the German Neonatal Network. both showed an association between a vitamin D deficiency of the mother (measurement of 25(OH)D in the early pregnancy) and a higher occurrence of SGA infants [22,23]. Clin Chim Acta. Genetic predisposition for vitamin D deficiency is not associated with adverse outcome of very low birth weight infants: A cohort study from the German Neonatal Network. Postnatal vitamin D supplementation is standard of care in neonates and preterm infants. The inclusion criteria were a birth weight below 1500g, a gestational age below 37 weeks + 0 days of pregnancy and a birth in one of the participating hospitals. -. rs12794714 is located on chromosome 11 in the CYP2R1-gene encoding the vitamin D 25-hydroxylase. These SNPs encode enzymes which are important for the vitamin D synthesis pathway. Despite routine supplementation of vitamin D, a wide range of complications related to vitamin D deficiency has been described in the literature. Click through the PLOS taxonomy to find articles in your field. Methodology, This study was funded by the German Federal Ministry of Education and Research (GNN, BMBF 01ER0805 and BMBF 01ER1501). IVH and PVL was assessed by routine ultrasound of the brain. Total number of eligible patients between 2009 and 2015 was 19136 (68% enrolment). Enteral iron supplementation in preterm and low birth weight infants. This study was approved by the ethics committee of the University of Lübeck, Germany (08–022) and at each participating center. T-test and Fisher’s exact test were used for statistical comparison. Copyright: © 2020 Mannhardt et al. Finally, standardized radiologic assessment of bone structure during the stay in the hospital is not part of the GNN-protocol. Vitamin D supplementation for women during pregnancy. Furthermore, we did not assess the number of children with vitamin D supplementation up to the age of 5 years. doi: 10.1002/14651858.CD005095.pub2. Since standard vitamin D supplementation might be not sufficient in preterm infants with a genetic predisposition for vitamin D deficiency, we investigated the outcome of preterm infants with regard to their genetic estimated vitamin D levels. Postnatal vitamin D supplementation is standard of care in neonates and preterm infants. -, Cândido FG, Bressan J. Vitamin D: Link between Osteoporosis, Obesity, and Diabetes? genetic predisposition for vitamin D deficiency would be more frequently SGA infants. For more information about PLOS Subject Areas, click In 2010, 14.9 million children were born as preterm infants (birth < 37+0 week of pregnancy), which accounts for 11.1% of all births worldwide [11]. Three of these loci are congruent to the ones used for this study. A genetic score for vitamin D (gsVitD) levels was calculated by gsVitD = (n1* -3) + (n2 * -2) + (n3 * -2.5), where the number of A-alleles of rs12794714 (0, 1 or 2) was entered as n1, the number of A-alleles of rs7944926 as n2 and the number of C-alleles of rs2282679 as n3. OBJECTIVES: To identify nutritional, endocrine and genetic factors related to calcium and vitamin D metabolism that are associated with OSM/rickets in females. Writing – original draft, -, Litonjua AA. Funding: This study was funded by the German Federal Ministry of Education and Research (GNN, BMBF 01ER0805 and BMBF 01ER1501). t-test for birth weight and gestational age, Fisher’s exact test for the remaining data. Objective: 10.1016/j.cca.2010.05.037 Prevention and treatment information (HHS). No, Is the Subject Area "Human genetics" applicable to this article? -, Tomaschitz A, Pilz S, Ritz E, Grammer T, Drechsler C, Boehm BO, et al. Birth weight and gestational age are indicated as mean ± standard deviation. Infants without 5-year follow up had a higher birth weight and gestational age, were less frequently multiples and more often SGA (S1 Table). In this study, for very low birth weight infants with a lower genetic score for vitamin D no higher risk could be shown to develop one of the mentioned complications during their first stay in the hospital. This was also true for other complications of prematurity. Latter could not show any positive effects of a vitamin D supplementation on the growth of infants [24] or on a lower incidence of cancer or cardiovascular complications [26]. For more information about PLOS Subject Areas, click No, Is the Subject Area "Genetics" applicable to this article? Writing – review & editing, Roles As an extension we tested this hypothesis according to birth weight, gestational age and weight, The effect of vitamin D is based on the increase of the concentrations of calcium and phosphate in the kidneys, the intestines and the bones and enhances the turnover of the bone matrix and the mobilization of calcium and phosphate from the bone. Yes Objectives To identify nutritional, endocrine and genetic factors related to calcium and vitamin D metabolism that are associated with OSM/rickets in females.. Is the Subject Area "Vitamin D" applicable to this article? Clinical data were collected by standardized questionnaires and regular onsite monitoring of participating centres. Leffelaar et al. We tested preterm infants with high and low vitamin D level estimates for neurologic complications of prematurity like IVH and PVL but were not able to detect any differences. here. However, plasma levels can alter from day to day and could be less informative for lifelong vitamin D status than genetic estimates. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Vitamin D Deficiency in the Gulf Cooperation Council: Exploring the Triad of Genetic Predisposition, the Gut Microbiome and the Immune System May 2019 Frontiers in Immunology 10:1042 Br J Nutr. Vitamin D and diabetes mellitus: an update 2013. We hypothesize that, considering the negative effects of vitamin D deficiency, a genetic predisposition to low vitamin D levels is detrimental to the outcome of premature infants. All SNPs were in Hardy Weinberg equilibrium. 2014. Methods: Results: The data underlying the results presented in the study ("Dataset is GNN_19_8_19") are available from German Neonatal Network (contact via gnn@uksh.de, www.vlbw.de). This hypothesis is tested by using a genetic score for vitamin D levels with a special focus on the appearance of typical complications of prematurity and fractures at the age of five years. A number of SNPs with validated effects on vitamin D levels are described in the literature. Study design A retrospective review of cases of vitamin D deficiency DCM presenting to a national paediatric cardiac centre between 1 January 2008 and 1 January 2018. BMJ. The vitamin D level was genetically calculated based on three single nucleotide polymorphisms (SNPs: rs12794714, rs7944926 and rs2282679) which alter vitamin D synthesis pathways. These SNPs have well-establishes associations with a reduction of the 25(OH)D concentration: a single “A”-allele of rs12794714 reduces 25(OH)D by 3.0 nmol/l, an “A”-allele of rs7944926 by 2.0 nmol/l and the “C”-allele of rs2282679 by 2.5 nmol/l [6,7,14,15]. 2013 Jul 14;110(1):156-63. doi: 10.1017/S0007114512004722. Formal analysis, Due to these studies, we pursued the hypothesis, that infants with a genetic predisposition for vitamin D deficiency would be more frequently SGA infants. Infants with a birth weight or length below the 10th percentile were defined as small-for-gestational-age (SGA) infants [17]. Project administration, We thank all participating patients, parents and physicians. Since approximately three quarters of the variability of the vitamin D level can be explained by genetic factors [14], more recent publications already use the calculation of the vitamin D levels based on individual genetic variables [6,21]. Methodology, According to their genetic predisposition, 1,924 preterm infants were divided into groups of low (gsVitD < 20. No, Is the Subject Area "Birth weight" applicable to this article? broad scope, and wide readership – a perfect fit for your research every time. were able to replicate four known and two new genome-wide significant genetic loci influencing 25-hydroxyvitamin D concentration [28]. 2016 Jan 14;(1):CD008873. The researchers found that people with a genetic predisposition for being heavier tended to have genes related to lower levels of vitamin D. Low genetic vitamin D level estimates could not be shown to be associated with any adverse outcome measures examined. Dr. Judson's voyage to restoring health. Such a deficiency is the reason for multiple skeletal health problems. Retinopathy of prematurity (ROP) was defined as any ROP with invasive treatment (laser- or cryotherapy or intraocular injection of VEGF-antibodies). April 17;15(4):6569–91. A probably more precise record of the vitamin D level would have been the measurement of the 25-hydroxyvitamin D. This would have required a blood sample of the children which could not have been performed in such a high number of participants. Munshi UK, Graziano PD, Meunier K, Ludke J, Rios A. J Pediatr Gastroenterol Nutr. For this work a blood culture proven bacteremia plus clinical signs was defined as sepsis and necrotizing enterocolitis was defined as necrosis of the intestine requiring surgery. Arq Bras Endocrinol Metabol. Strengths of our study include the large sample size and the highly standardized long-term follow-up. Our results are in line with the findings of a recently published study by Roth et al., showing no impact of a vitamin D supplementation of healthy pregnant women on the longitudinal growth of their babies at the age of one [24]. In adults, vitamin D deficiency is associated with increased risk for neurological complications, such as cerebral microangiopathies, lacunes and severe white matter hyperintensity [8]. Formal analysis, However, for rare endpoints like bone fractures even our sample size was not sufficient. We used standardized test, to assess their growth, neurocognitive development, fine and gross motor skills, hearing and visual ability, lung function and intelligence quotient. Vitamin D deficiency linked to genetic polymorphisms. Preterm infants with a birth weight below 1500 grams were included in the German Neonatal Network at the time of their birth and tested at the age of five. Accessibility Funding acquisition, It has to be investigated in even larger sample sizes if the small difference observed in our cohort is actually associated with insufficient vitamin D levels and if additional supplementation of vitamin D to these infants can be helpful. Since in adults the main growth of the bones is finished and the epiphyseal plates are closed, a vitamin D deficiency results in osteomalacia. Vitamin D deficiency might negatively impact prematurity due to its wide range of effects [1], including obesity, diabetes mellitus, allergies, cancer, arterial hypertension and increased risk for neurological complications [2–8]. Since prolonged use of vitamin D supplements might be more common in premature infants and is associated with reduced fracture risk [27] our data are not representative for healthy neonates. Chowdhury R, Kunutsor S, Vitezova A, Oliver-Williams C, Chowdhury S, Kiefte-de-Jong JC, et al. Conceptualization, https://doi.org/10.1371/journal.pone.0230426.t003. Data curation, June;9(3):202–7. 10.1097/ACI.0b013e32832b36cd All data were collected in a central database at the University of Lübeck. Percental occurrence of bone fractures of the examined children until the age of…, National Library of Medicine 2014. Until recently, the usual response would be, “Oh, well. The Genetic Score from the same 3 skin pigmentation gene variants was also associated with severe vitamin D deficiency, defined as serum 25(OH)D levels <12 ng/mL. Conceptualization, Specific alleles of these polymorphisms are validated markers for low plasma vitamin D levels. Objective To determine the incidence, demography and prognosis of vitamin D deficiency dilated cardiomyopathy (DCM) in Scotland over the last decade. Yes Thresholds for the 20th and 80th percentile of gsVitD were -7.6 and -2.9 nmol/l. 2014. Citation: Mannhardt C, Rausch TK, Fortmann MI, Swoboda I, Humberg A, Spiegler J, et al. Kosik K, Szpecht D, Al-Saad SR, Karbowski LM, Kurzawińska G, Szymankiewicz M, Drews K, Wolski H, Seremak-Mrozikiewicz A. Sci Rep. 2020 Dec 3;10(1):21098. doi: 10.1038/s41598-020-78125-4. (everydayhealth.com) The Sunshine Vitamin: Get Your Vitamin D (everydayhealth.com) Widespread vitamin D deficiency a concern in Asia (eurekalert.org) Widespread vitamin D deficiency … No, Is the Subject Area "Single nucleotide polymorphisms" applicable to this article? Genetic predisposition for vitamin D deficiency is not associated with adverse outcome of very low birth weight infants: A cohort study from the German Neonatal Network 1. Mortality in infants with low genetic score for vitamin D (n = 2,336) was 2.7% compared to 3.3% in infants with intermediate scores (n = 6,849) and 2.9% in infants with high genetic score for vitamin D (n = 2,345, p = 0.72 compared to low genetic score for vitamin D, Fisher’s exact test). SGA = small-for-gestational-age, IVH = intraventricular hemorrhage, PVL = periventricular leukomalacia, BPD = bronchopulmonary dysplasia, NEC = necrotizing enterocolitis. Postnatal vitamin D supplementation is standard of care in neonates and preterm infants. https://doi.org/10.1371/journal.pone.0230426.t002. Low genetic vitamin D level estimates could not be shown to be associated with previously described adverse outcome in preterm infants. Predisposition to vitamin D deficiency osteomalacia and rickets in females is linked to their 25(OH)D and calcium intake rather than vitamin D receptor gene polymorphism. Writing – review & editing, Affiliation Independent association between 1,25-dihydroxyvitamin D, 25-hydroxyvitamin D and the renin-angiotensin system: The Ludwigshafen Risk and Cardiovascular Health (LURIC) study. Specific alleles of these polymorphisms are validated markers for low plasma vitamin D levels. T-test and Fisher's exact test were used for statistical comparison. Clipboard, Search History, and several other advanced features are temporarily unavailable. The statistical analysis was performed with SPSS®, version 22.0. FOIA Bethesda, MD 20894, Copyright RESEARCH DESIGN AND METHODS: We measured 25(OH)D … and Bodnar et al. Growth data (height, weight, body mass index and head circumference) at the age of five did not differ with regard to gsvitD status (Table 3). Investigation, Head of the study: Prof. Dr. Wolfgang Göpel. Bronchopulmonary dysplasia (BPD) was defined as the need of oxygen or respiratory support at 36+0 weeks of pregnancy [20]. Writing – review & editing, Roles